![]() The staining procedure was described previously 6.įor dual-luciferase reporter assays, animal caps and embryos were collected and excess medium was removed. Beta-galactosidase staining and luciferase assayĪlbino Xenopus embryos injected with beta-galactosidase reporter gene were fixed at various stages, and stained with X-Gal. Both reactions were carried out with cap analog/GTP ratio 5:1. The plasmid psp64T-activin bb (a gift from Harland RM) was linearized with XbaI and transcripted by SP6 RNA polymerase, pCDNA1.1-ArmdNXTcf-3 (a gift from Roose J), which encodes the fusion protein containing the activation domain (694-844 aa) of Drosophila Armadillo and N-terminus (1-31 aa) deleted Tcf-3 of Xenopus, and has the constitutive dorsalizing activitiy, was linearized with XbaI and transcripted by T7 RNA polymerase. The 1556 bp 5′ flanking fragment and its serial deletions were then cloned into firefly luciferase based pG元-basic with KpnI/BamHI and KpnI/BglII sites, and respectively named as 1556-Luc, 797-Luc, 657-Luc, 329-Luc and 1556(-229)-Luc. Serial deletions were obtained by the following processes: pSK-N1556 were double digested with either EcoRI/NdeI, EcoRI/StuI, EcoRI/HindIII or HindIII/StuI, blunted by Klenow and then religated, resulting in serial deletions: pSK-N797, pSK-N657, pSK-N329 and pSK-N1556(-229). This reporter construct was named 2066-LacZ.ġ556bp 5′ flanking region was amplified from pSK-N2066 by PCR with T7 primer and noggin specific primer 5′ gcctggctaatggatcctaagtagcc 3′ (1545-1570 bp in Fig 1B, introducing a BamHI site by substituting aa with gg bases for cloning convenience), and inserted into pBluescript SK- vector with EcoRI/ BamHI sites. Construction of expression plasmidsįunctional beta-galactosidase gene was cloned from pCH110 (phamarcia) with BamHI/HindIII (blunted) into pSK-N2066 with BamHI/SmaI. Furthermore, a 229 bp fragment has been identified to be essential for the basal promoter activity by serial deletion analysis.įoreward: 5′actttctctggttgcatccc 3′ reverse: 5′acctagcgaattggggattc 3′. Reporter gene assays indicated that this genomic sequence was able to direct reporter gene to express in vivo and respond to activin and Wnt signalings. To this aim, we cloned a 1.5 kb noggin 5′ upstream DNA by screening a partial Xenopus genomic library. Therefore, to analyze the regulation of noggin expression will help greatly in understanding the establishment of the organizer. It can also induce an imcomplete additional body axis when mis-expressed in ventral marginal zone 5. NOGGIN, a secreted factor, is expressed in the organizer region during gastrulation and has nearly all characterestic properties of the organzier, such as in patterning body axis, dorsalizing ventral mesodrm and converting prospective ectoderm to neural ectoderm. However, how these maternal inherited factors induce the formation of the organizer, in terms of initiating the expression of organizer spesific genes, remains unclear. These two kinds of maternal signals orchestrated in the vegetal dorsal territories of blastula, resulting in the establishment of the organizer. Increasing evidence also revealed that components of Wnt signaling pathway have been implicated in dorsalization of mesoderm 2. The most promising candidates of mesoderm-inducing signals are factors encoded by genes of the members of transforming growth factor-beta (activin, Vg1, BMP-4, nodal related genes etc.) and fibroblast growth factor super families 3, 4. It's generally accepted that mesoderm-inducing signals and dorsal determinants are both necessary for the formation of the organizer 2. The organizer is progressively induced during blastula stage by maternal inducing signals. Due to the functional importance of the organizer, intense efforts have been placed on deciphering its molecular properties and in past decades dozens of organizer genes have been identified(reviewed by Heasman J 2). Transplanting a small piece of dorsal lip into the ventral side of another embryo causes the formation of a secondary axis, resulting in a twinned embryo and thus, the dorsal lip of blastopore is named “the organizer” 1. The dorsal blastopore lip of Xenopus early gastrulae plays a key role in specifying the body axis.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |